language:
Find link is a tool written by Edward Betts.searching for recognition sequence 65 found (100 total)
alternate case: Recognition sequence
Nuclear localization sequence
(2,028 words)
[view diff]
no match in snippet
view article
find links to article
A nuclear localization signal or sequence (NLS) is an amino acid sequence that 'tags' a protein for import into the cell nucleus by nuclear transport.Puzzle video game (1,231 words) [view diff] no match in snippet view article find links to article
puzzles can test problem-solving skills, including logic, pattern recognition, sequence solving, spatial recognition, and word completion. Many puzzle gamesNdeI (348 words) [view diff] exact match in snippet view article find links to article
molecular biology, it is commonly used as a restriction enzyme. Recognition sequence of NdeI: 5'CATATG 3'GTATAC The ends generated by NdeI digest: 5'---CACDH12 (647 words) [view diff] exact match in snippet view article find links to article
cadherins are defined based on their lack of an HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin appears toCDH16 (773 words) [view diff] exact match in snippet view article find links to article
cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively inEcoRI (891 words) [view diff] exact match in snippet view article find links to article
nucleotide sticky ends with 5' end overhangs of AATT. The nucleic acid recognition sequence where the enzyme cuts is G↓AATTC, which has a palindromic complementaryEndonuclease (2,688 words) [view diff] exact match in snippet view article find links to article
cleave at random sites of about 1000 base pairs or more from the recognition sequence and it requires ATP as source of energy. Type II behaves slightlyCfr10I/Bse634I (254 words) [view diff] exact match in snippet view article find links to article
the double-stranded sequence RCCGGY and cleave after the purine R. Recognition sequence Cut 5' RCCGGY 5' ---R CCGGY--- 3' 3' YGGCCR 3' ---YGGCC R--- 5' GrazulisMeganuclease (2,295 words) [view diff] exact match in snippet view article find links to article
or modify sequences in a highly targeted way. By modifying their recognition sequence through protein engineering, the targeted sequence can be changedIntegrin alpha 6 (404 words) [view diff] exact match in snippet view article find links to article
sites in integrin alpha subunits. T14853, TIP/GIPC binds to a type I recognition sequence in alpha 6A/alpha 5 and a novel sequence in alpha 6B". The JournalCDH8 (590 words) [view diff] exact match in snippet view article find links to article
cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressedIntegrin alpha 5 (444 words) [view diff] exact match in snippet view article find links to article
sites in integrin alpha subunits. T14853, TIP/GIPC binds to a type I recognition sequence in alpha 6A/alpha 5 and a novel sequence in alpha 6B". J. Biol. ChemU2 spliceosomal RNA (1,784 words) [view diff] exact match in snippet view article find links to article
structural proteins associate with Sm snRNAs through a highly conserved recognition sequence (AUnG,n = 4-6) located within the RNA called Sm-binding sites. TwoZNF217 (967 words) [view diff] exact match in snippet view article find links to article
transcriptional repressor complex: identification of a ZNF217 consensus recognition sequence". Oncogene. 26 (23): 3378–86. doi:10.1038/sj.onc.1210126. PMID 17130829Apetala 2 (953 words) [view diff] exact match in snippet view article find links to article
T (1999). "RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higherRestriction modification system (2,623 words) [view diff] exact match in snippet view article find links to article
and methylation. Cleavage occurs at variable distances from the recognition sequence, so discrete bands are not easily visualized by gel electrophoresisHaeIII (496 words) [view diff] exact match in snippet view article find links to article
methyltransferase also known as MTase gene from Haemophilus aegyptius (recognition sequence: 5′-GGCC-3′) was made into Escherichia coli (E.coli) in the plasmidMicroviridae (2,391 words) [view diff] exact match in snippet view article find links to article
PD, Jansz HS, van der Marel GA, Veeneman GH, van Boom JH (1980) Recognition sequence of bacteriophage phi X174 gene A protein--an initiator of DNA replicationNlaIII (680 words) [view diff] exact match in snippet view article find links to article
for gastric cancer NlaIII isoschizomers recognize and cut the same recognition sequence 5’-CATG-3’. Endonucleases that cut at this sequence include: FaelCDH11 (1,192 words) [view diff] exact match in snippet view article find links to article
cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Expression of this particular cadherinSCN7A (1,560 words) [view diff] exact match in snippet view article find links to article
voltage-gated channel in these animals and carry the ancestral "D/E/E/A" ion recognition sequence. Sodium channel GRCh38: Ensembl release 89: ENSG00000136546 – EnsemblR.EcoRII (684 words) [view diff] exact match in snippet view article find links to article
interacts with two or three copies of the pseudopalindromic DNA recognition sequence 5'-CCWGG-3' (W = A or T), one being the actual target of cleavageMiR-132 (1,850 words) [view diff] exact match in snippet view article find links to article
may also be responsible for limiting inflammation in the brain. A recognition sequence for this miRNA can be found in the mRNA for acetylcholinesteraseBatroxobin (2,037 words) [view diff] exact match in snippet view article find links to article
successfully expressed the cDNA for batroxobin in E. Coli in 1990 The recognition sequence for thrombin was used to obtain mature batroxobin. The fusion proteinGIPC1 (1,893 words) [view diff] exact match in snippet view article find links to article
sites in integrin alpha subunits. T14853, TIP/GIPC binds to a type I recognition sequence in alpha 6A/alpha 5 and a novel sequence in alpha 6B". J. Biol. ChemRibosomally synthesized and post-translationally modified peptides (6,148 words) [view diff] exact match in snippet view article find links to article
also differ from other RiPPs based on the presence of a C-terminal recognition sequence in addition to the N-terminal leader peptide. α-Amanitin, an amatoxinIntegrin alpha 9 (934 words) [view diff] exact match in snippet view article find links to article
Sheppard D (2000). "The integrin alpha(9)beta(1) binds to a novel recognition sequence (SVVYGLR) in the thrombin-cleaved amino-terminal fragment of osteopontin"STX2 (1,272 words) [view diff] exact match in snippet view article find links to article
PMID 9110174. Koshida S, Hirai Y (May 1997). "Identification of cellular recognition sequence of epimorphin and critical role of cell/epimorphin interaction inSmall nucleolar RNA (3,791 words) [view diff] exact match in snippet view article find links to article
the uridine on the target rRNA that is going to be modified. This recognition sequence is bipartite (constructed from the two different arms of the loopPalindromic sequence (823 words) [view diff] case mismatch in snippet view article find links to article
Enzyme Source Recognition Sequence Cut EcoR1 Escherichia coli 5'GAATTC 3'CTTAAG 5'---G AATTC---3' 3'---CTTAA G---5' BamH1 Bacillus amyloliquefaciens 5'GGATCCIGFBP7 (2,499 words) [view diff] exact match in snippet view article find links to article
contains a proposed heparin binding site and is also part of the recognition sequence for proteolytic cleavage. Heparin binding inhibits cell binding andDEAD box (1,436 words) [view diff] exact match in snippet view article find links to article
conformational rearrangement of U2 snRNA, which makes the branch point–recognition sequence of U2 available to bind the branch point sequence. Prp28 may haveSequence labeling (503 words) [view diff] case mismatch in snippet view article find links to article
where the "label" is actually a real number Machine learning Pattern recognition Sequence mining Erdogan H., [1]. "Sequence labeling: generative and discriminativeCRISPR (16,350 words) [view diff] exact match in snippet view article find links to article
downstream from the PAM site. This means there is no disruption to the recognition sequence after repair, and so Cas12a enables multiple rounds of DNA cleavageVariable-order Markov model (1,140 words) [view diff] no match in snippet view article find links to article
statistical process control, spam filtering, haplotyping, speech recognition, sequence analysis in social sciences, and others. Stochastic chains withTGFBI (1,145 words) [view diff] exact match in snippet view article find links to article
matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagenArthrobacter luteus (565 words) [view diff] exact match in snippet view article find links to article
analysis of DNA. 28. Arthrobacter luteus restriction endonuclease recognition sequence and its cleavage map of SV40 DNA". Biochemistry. 15 (16): 3612–3620Pattern recognition (4,267 words) [view diff] case mismatch in snippet view article find links to article
Perceptual learning Predictive analytics Prior knowledge for pattern recognition Sequence mining Template matching Contextual image classification List ofDnaG (2,544 words) [view diff] exact match in snippet view article find links to article
template sequence binds to DnaG. The ssDNA contains a three nucleotide recognition sequence that recruits NTPs based on Watson-Crick base pairing. After bindingAlu element (3,083 words) [view diff] exact match in snippet view article find links to article
TATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC. The recognition sequence of the Alu I endonuclease is 5' ag/ct 3'; that is, the enzyme cutsHindIII (1,045 words) [view diff] exact match in snippet view article find links to article
restriction enzyme will form 15-20 hydrogen bonds with the bases of the recognition sequence. With the aid of other van der Waals interactions, this bonding facilitatesNKTR (545 words) [view diff] exact match in snippet view article find links to article
PMID 8144875. S2CID 20265645. "Entrez Gene: NKTR natural killer-tumor recognition sequence". Frey JL, Bino T, Kantor RR, et al. (1992). "Mechanism of targetJohn G. Cleary (576 words) [view diff] no match in snippet view article find links to article
variety of problems including document classification, named-entity recognition, sequence alignment, SNV calling from NGS data, and various problems in metagenomicsP element (2,029 words) [view diff] exact match in snippet view article find links to article
transposon, and moves by a DNA-based "cut and paste" mechanism. The recognition sequence comprises four exons separated by three introns. Complete splicingOligomer restriction (1,020 words) [view diff] exact match in snippet view article find links to article
Not all restriction enzymes have the desired specificity for their recognition sequence. Some can recognize and cut single-stranded DNA, and some show aBert Vogelstein (3,823 words) [view diff] exact match in snippet view article find links to article
a sequence-specific manner. They precisely defined its consensus recognition sequence and showed that virtually all p53 mutations found in tumors resultedAryl hydrocarbon receptor (5,962 words) [view diff] exact match in snippet view article find links to article
aryl hydrocarbon (dioxin) receptor complex on its asymmetric DNA recognition sequence". Molecular Pharmacology. 47 (3): 432–438. PMID 7700240. SwansonIntragenomic conflict (2,217 words) [view diff] exact match in snippet view article find links to article
HEG as template. HEGs encode sequence-specific endonucleases. The recognition sequence (RS) is 15–30 bp long and usually occurs once in the genome. HEGsT-box leader (1,013 words) [view diff] exact match in snippet view article find links to article
downstream coding sequence. The specifier sequence is the first recognition sequence in the leader. It is complementary to the anticodon of the tRNA thatOutline of video games (3,793 words) [view diff] no match in snippet view article find links to article
that emphasize puzzle solving, including logic, strategy, pattern recognition, sequence solving, and word completion. Serious game – a video game designedExpanded genetic code (9,128 words) [view diff] exact match in snippet view article find links to article
achieved by changing the recognition sequence of the mRNA, the Shine-Dalgarno sequence, and the corresponding recognition sequence in the 16S rRNA of ribosomesEukaryotic transcription (5,861 words) [view diff] exact match in snippet view article find links to article
promoters. For example, the TATA box is the highly conserved DNA recognition sequence for the TATA box binding protein, TBP, whose binding initiates transcriptionDNA methylation (13,166 words) [view diff] exact match in snippet view article find links to article
does not belong to a restriction/modification system. The target recognition sequence for E. coli Dam is GATC, as the methylation occurs at the N6 positionList of video game genres (13,055 words) [view diff] no match in snippet view article find links to article
test the player's problem-solving skills including logic, pattern recognition, sequence solving, and word completion. Puzzle games continue to find millionsPTC tasting (1,442 words) [view diff] exact match in snippet view article find links to article
with the restriction enzyme HaeIII, comprising the SNP in their recognition sequence GGCC. HaeIII cuts the taster allele (having the sequence GGCC); thisDNA adenine methylase (1,844 words) [view diff] exact match in snippet view article find links to article
PMC 285375. PMID 4576399. Geier GE, Modrich P (February 1979). "Recognition sequence of the dam methylase of Escherichia coli K12 and mode of cleavageArginylglycylaspartic acid (3,744 words) [view diff] exact match in snippet view article find links to article
which promotes cell adhesion. RGD was identified as the minimal recognition sequence within fibronectin required for cell attachment by Ruoslahti andGlossary of cellular and molecular biology (0–L) (24,805 words) [view diff] exact match in snippet view article
disequilibrium linker DNA 1. A short, synthetic DNA duplex containing the recognition sequence for a particular restriction enzyme. In molecular cloning, linkersOff-target genome editing (6,822 words) [view diff] exact match in snippet view article find links to article
a Cas9 protein, a recognition sequence RNA, and a transactivating RNA are required. The fusion of both the recognition sequence specificity CRISPR RNAZNF548 (1,226 words) [view diff] exact match in snippet view article find links to article
Polymerase II. It has the ability to bind to a transcription factor recognition sequence that is on the same strand (cis) as the transcription start siteTherapeutic gene modulation (3,994 words) [view diff] exact match in snippet view article find links to article
structural drawback to unmodified SPAs as gene modulators is that their recognition sequence cannot be extended beyond 5 Watson-Crick base pairings. The naturalZinc finger nuclease treatment of HIV (3,400 words) [view diff] exact match in snippet view article find links to article
Nitrogen 7 and Oxygen 6 of guanine at the 5’ end enhancing the site recognition sequence of zinc fingers. The histidine coordinated to the zinc atom, whichRhomboid protease (4,629 words) [view diff] exact match in snippet view article find links to article
and a cluster of basic residues. This domain appears to be the recognition sequence for rhombosortase, a branch of the rhomboid protease family limitedTenomodulin (3,317 words) [view diff] exact match in snippet view article find links to article
31-49) and no signal peptide. TNMD contains a putative protease recognition sequence (Arg-Xxx-Xxx-Arg) identified at the position 233-236. Unlike chondromodulin-1SLC46A3 (6,550 words) [view diff] exact match in snippet view article find links to article
Functional Sites in Proteins). Pandey KN (October 2010). "Small peptide recognition sequence for intracellular sorting". Current Opinion in Biotechnology. 21