Find link

language:

Find link is a tool written by Edward Betts.

searching for Recognition sequence 66 found (102 total)

Nuclear localization sequence (2,036 words) [view diff] no match in snippet view article find links to article

A nuclear localization signal or sequence (NLS) is an amino acid sequence that 'tags' a protein for import into the cell nucleus by nuclear transport.

Puzzle video game (1,288 words) [view diff] no match in snippet view article find links to article

puzzles can test problem-solving skills, including logic, pattern recognition, sequence solving, spatial recognition, and word completion. Many puzzle games

NotI (51 words) [view diff] exact match in snippet view article find links to article

enzyme isolated from the bacterium Nocardia otitidis. Palindromic recognition sequence of NotI: 5'-GCGGCCGC-3' 3'-CGCCGGCG-5' The ends generated by NotI

NdeI (346 words) [view diff] exact match in snippet view article find links to article

molecular biology, it is commonly used as a restriction enzyme. Recognition sequence of NdeI: 5'CATATG 3'GTATAC The ends generated by NdeI digest: 5'---CA

CDH12 (647 words) [view diff] exact match in snippet view article find links to article

cadherins are defined based on their lack of an HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin appears to

CDH16 (773 words) [view diff] exact match in snippet view article find links to article

cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in

EcoRI (891 words) [view diff] exact match in snippet view article find links to article

nucleotide sticky ends with 5' end overhangs of AATT. The nucleic acid recognition sequence where the enzyme cuts is G↓AATTC, which has a palindromic complementary

Endonuclease (2,688 words) [view diff] exact match in snippet view article find links to article

cleave at random sites of about 1000 base pairs or more from the recognition sequence and it requires ATP as source of energy. Type II behaves slightly

Cfr10I/Bse634I (254 words) [view diff] exact match in snippet view article find links to article

the double-stranded sequence RCCGGY and cleave after the purine R. Recognition sequence Cut 5' RCCGGY 5' ---R CCGGY--- 3' 3' YGGCCR 3' ---YGGCC R--- 5' Grazulis

Meganuclease (2,295 words) [view diff] exact match in snippet view article find links to article

or modify sequences in a highly targeted way. By modifying their recognition sequence through protein engineering, the targeted sequence can be changed

Integrin alpha 6 (404 words) [view diff] exact match in snippet view article find links to article

sites in integrin alpha subunits. T14853, TIP/GIPC binds to a type I recognition sequence in alpha 6A/alpha 5 and a novel sequence in alpha 6B". The Journal

CDH8 (588 words) [view diff] exact match in snippet view article find links to article

cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed

Integrin alpha 5 (444 words) [view diff] exact match in snippet view article find links to article

sites in integrin alpha subunits. T14853, TIP/GIPC binds to a type I recognition sequence in alpha 6A/alpha 5 and a novel sequence in alpha 6B". J. Biol. Chem

Apetala 2 (953 words) [view diff] exact match in snippet view article find links to article

T (1999). "RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher

ZNF217 (967 words) [view diff] exact match in snippet view article find links to article

transcriptional repressor complex: identification of a ZNF217 consensus recognition sequence". Oncogene. 26 (23): 3378–86. doi:10.1038/sj.onc.1210126. PMID 17130829

Restriction modification system (2,668 words) [view diff] exact match in snippet view article find links to article

and methylation. Cleavage occurs at variable distances from the recognition sequence, so discrete bands are not easily visualized by gel electrophoresis

U2 spliceosomal RNA (1,784 words) [view diff] exact match in snippet view article find links to article

structural proteins associate with Sm snRNAs through a highly conserved recognition sequence (AUnG,n = 4-6) located within the RNA called Sm-binding sites. Two

Microviridae (2,393 words) [view diff] exact match in snippet view article find links to article

PD, Jansz HS, van der Marel GA, Veeneman GH, van Boom JH (1980) Recognition sequence of bacteriophage phi X174 gene A protein--an initiator of DNA replication

HaeIII (497 words) [view diff] exact match in snippet view article find links to article

methyltransferase also known as the MTase gene from Haemophilus aegyptius (recognition sequence: 5′-GGCC-3′) was made into Escherichia coli (E.coli) in the plasmid

NlaIII (683 words) [view diff] exact match in snippet view article find links to article

for gastric cancer NlaIII isoschizomers recognize and cut the same recognition sequence 5’-CATG-3’. Endonucleases that cut at this sequence include: Fael

CDH11 (1,192 words) [view diff] exact match in snippet view article find links to article

cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Expression of this particular cadherin

SCN7A (1,514 words) [view diff] exact match in snippet view article find links to article

voltage-gated channel in these animals and carry the ancestral "D/E/E/A" ion recognition sequence. Sodium channel GRCh38: Ensembl release 89: ENSG00000136546 – Ensembl

MiR-132 (1,856 words) [view diff] exact match in snippet view article find links to article

may also be responsible for limiting inflammation in the brain. A recognition sequence for this miRNA can be found in the mRNA for acetylcholinesterase

R.EcoRII (685 words) [view diff] exact match in snippet view article find links to article

interacts with two or three copies of the pseudopalindromic DNA recognition sequence 5'-CCWGG-3' (W = A or T), one being the actual target of cleavage

Batroxobin (2,033 words) [view diff] exact match in snippet view article find links to article

successfully expressed the cDNA for batroxobin in E. Coli in 1990 The recognition sequence for thrombin was used to obtain mature batroxobin. The fusion protein

GIPC1 (1,893 words) [view diff] exact match in snippet view article find links to article

sites in integrin alpha subunits. T14853, TIP/GIPC binds to a type I recognition sequence in alpha 6A/alpha 5 and a novel sequence in alpha 6B". J. Biol. Chem

Ribosomally synthesized and post-translationally modified peptides (6,238 words) [view diff] exact match in snippet view article find links to article

also differ from other RiPPs based on the presence of a C-terminal recognition sequence in addition to the N-terminal leader peptide. α-Amanitin, an amatoxin

Integrin alpha 9 (934 words) [view diff] exact match in snippet view article find links to article

Sheppard D (2000). "The integrin alpha(9)beta(1) binds to a novel recognition sequence (SVVYGLR) in the thrombin-cleaved amino-terminal fragment of osteopontin"

STX2 (1,272 words) [view diff] exact match in snippet view article find links to article

PMID 9110174. Koshida S, Hirai Y (May 1997). "Identification of cellular recognition sequence of epimorphin and critical role of cell/epimorphin interaction in

IGFBP7 (2,520 words) [view diff] exact match in snippet view article find links to article

contains a proposed heparin binding site and is also part of the recognition sequence for proteolytic cleavage. Heparin binding inhibits cell binding and

Palindromic sequence (825 words) [view diff] case mismatch in snippet view article find links to article

Enzyme Source Recognition Sequence Cut EcoR1 Escherichia coli 5'GAATTC 3'CTTAAG 5'---G AATTC---3' 3'---CTTAA G---5' BamH1 Bacillus amyloliquefaciens 5'GGATCC

DEAD box (1,436 words) [view diff] exact match in snippet view article find links to article

conformational rearrangement of U2 snRNA, which makes the branch point–recognition sequence of U2 available to bind the branch point sequence. Prp28 may have

Small nucleolar RNA (3,892 words) [view diff] exact match in snippet view article find links to article

the uridine on the target rRNA that is going to be modified. This recognition sequence is bipartite (constructed from the two different arms of the loop

Cas12a (2,638 words) [view diff] exact match in snippet view article find links to article

downstream from the PAM site. This characteristic ensures that the recognition sequence remains intact after repair, enabling Cas12a to perform multiple

Sequence labeling (503 words) [view diff] case mismatch in snippet view article find links to article

where the "label" is actually a real number Machine learning Pattern recognition Sequence mining Erdogan H., [1]. "Sequence labeling: generative and discriminative

Variable-order Markov model (1,140 words) [view diff] no match in snippet view article find links to article

statistical process control, spam filtering, haplotyping, speech recognition, sequence analysis in social sciences, and others. Stochastic chains with

TGFBI (1,145 words) [view diff] exact match in snippet view article find links to article

matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen

Pattern recognition (4,354 words) [view diff] case mismatch in snippet view article find links to article

make predictions about unknown events Prior knowledge for pattern recognition Sequence mining Template matching – Technique in digital image processing

Arthrobacter luteus (565 words) [view diff] exact match in snippet view article find links to article

analysis of DNA. 28. Arthrobacter luteus restriction endonuclease recognition sequence and its cleavage map of SV40 DNA". Biochemistry. 15 (16): 3612–3620

Alu element (3,107 words) [view diff] exact match in snippet view article find links to article

TATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC. The recognition sequence of the Alu I endonuclease is 5' ag/ct 3'; that is, the enzyme cuts

DnaG (2,544 words) [view diff] exact match in snippet view article find links to article

template sequence binds to DnaG. The ssDNA contains a three nucleotide recognition sequence that recruits NTPs based on Watson-Crick base pairing. After binding

HindIII (1,080 words) [view diff] exact match in snippet view article find links to article

restriction enzyme will form 15-20 hydrogen bonds with the bases of the recognition sequence. With the aid of other van der Waals interactions, this bonding facilitates

P element (2,029 words) [view diff] exact match in snippet view article find links to article

transposon, and moves by a DNA-based "cut and paste" mechanism. The recognition sequence comprises four exons separated by three introns. Complete splicing

John G. Cleary (576 words) [view diff] no match in snippet view article find links to article

variety of problems including document classification, named-entity recognition, sequence alignment, SNV calling from NGS data, and various problems in metagenomics

NKTR (545 words) [view diff] exact match in snippet view article find links to article

PMID 8144875. S2CID 20265645. "Entrez Gene: NKTR natural killer-tumor recognition sequence". Frey JL, Bino T, Kantor RR, et al. (1992). "Mechanism of target

Bert Vogelstein (3,828 words) [view diff] exact match in snippet view article find links to article

a sequence-specific manner. They precisely defined its consensus recognition sequence and showed that virtually all p53 mutations found in tumors resulted

Oligomer restriction (1,020 words) [view diff] exact match in snippet view article find links to article

Not all restriction enzymes have the desired specificity for their recognition sequence. Some can recognize and cut single-stranded DNA, and some show a

Aryl hydrocarbon receptor (5,999 words) [view diff] exact match in snippet view article find links to article

aryl hydrocarbon (dioxin) receptor complex on its asymmetric DNA recognition sequence". Molecular Pharmacology. 47 (3): 432–438. doi:10.1016/S0026-895X(25)08562-1

Intragenomic conflict (2,232 words) [view diff] exact match in snippet view article find links to article

HEG as template. HEGs encode sequence-specific endonucleases. The recognition sequence (RS) is 15–30 bp long and usually occurs once in the genome. HEGs

T-box leader (1,013 words) [view diff] exact match in snippet view article find links to article

downstream coding sequence. The specifier sequence is the first recognition sequence in the leader. It is complementary to the anticodon of the tRNA that

Outline of video games (3,790 words) [view diff] no match in snippet view article find links to article

that emphasize puzzle solving, including logic, strategy, pattern recognition, sequence solving, and word completion. Serious game – a video game designed

Expanded genetic code (9,144 words) [view diff] exact match in snippet view article find links to article

achieved by changing the recognition sequence of the mRNA, the Shine-Dalgarno sequence, and the corresponding recognition sequence in the 16S rRNA of ribosomes

Eukaryotic transcription (5,867 words) [view diff] exact match in snippet view article find links to article

promoters. For example, the TATA box is the highly conserved DNA recognition sequence for the TATA box binding protein, TBP, whose binding initiates transcription

DNA methylation (13,348 words) [view diff] exact match in snippet view article find links to article

does not belong to a restriction/modification system. The target recognition sequence for E. coli Dam is GATC, as the methylation occurs at the N6 position

List of video game genres (13,077 words) [view diff] no match in snippet view article find links to article

test the player's problem-solving skills including logic, pattern recognition, sequence solving, and word completion. Puzzle games continue to find millions

DNA adenine methylase (1,844 words) [view diff] exact match in snippet view article find links to article

PMC 285375. PMID 4576399. Geier GE, Modrich P (February 1979). "Recognition sequence of the dam methylase of Escherichia coli K12 and mode of cleavage

PTC tasting (1,442 words) [view diff] exact match in snippet view article find links to article

with the restriction enzyme HaeIII, comprising the SNP in their recognition sequence GGCC. HaeIII cuts the taster allele (having the sequence GGCC); this

Arginylglycylaspartic acid (3,744 words) [view diff] exact match in snippet view article find links to article

which promotes cell adhesion. RGD was identified as the minimal recognition sequence within fibronectin required for cell attachment by Ruoslahti and

Glossary of cellular and molecular biology (0–L) (30,347 words) [view diff] exact match in snippet view article

one or more homeodomains, each of which is specific to a different recognition sequence. Many homeodomain-containing proteins function as transcription factors

Off-target genome editing (7,122 words) [view diff] exact match in snippet view article find links to article

a Cas9 protein, a recognition sequence RNA, and a transactivating RNA are required. The fusion of both the recognition sequence specificity CRISPR RNA

ZNF548 (1,226 words) [view diff] exact match in snippet view article find links to article

Polymerase II. It has the ability to bind to a transcription factor recognition sequence that is on the same strand (cis) as the transcription start site

Therapeutic gene modulation (3,994 words) [view diff] exact match in snippet view article find links to article

structural drawback to unmodified SPAs as gene modulators is that their recognition sequence cannot be extended beyond 5 Watson-Crick base pairings. The natural

Zinc finger nuclease treatment of HIV (3,400 words) [view diff] exact match in snippet view article find links to article

Nitrogen 7 and Oxygen 6 of guanine at the 5’ end enhancing the site recognition sequence of zinc fingers. The histidine coordinated to the zinc atom, which

Rhomboid protease (4,629 words) [view diff] exact match in snippet view article find links to article

and a cluster of basic residues. This domain appears to be the recognition sequence for rhombosortase, a branch of the rhomboid protease family limited

Tenomodulin (3,311 words) [view diff] exact match in snippet view article find links to article

31-49) and no signal peptide. TNMD contains a putative protease recognition sequence (Arg-Xxx-Xxx-Arg) identified at the position 233-236. Unlike chondromodulin-1

SLC46A3 (6,550 words) [view diff] exact match in snippet view article find links to article

Functional Sites in Proteins). Pandey KN (October 2010). "Small peptide recognition sequence for intracellular sorting". Current Opinion in Biotechnology. 21