Find link

language:

jump to random article

Find link is a tool written by Edward Betts.

Longer titles found: Puma lentivirus (view)

searching for Lentivirus 51 found (123 total)

alternate case: lentivirus

ROSA26 (230 words) [view diff] exact match in snippet view article find links to article

ROSA stands for Reverse Orientation Splice Acceptor, named after the lentivirus genetrap vector. "rosa26". Retrieved 8 January 2013. CS1 maint: discouraged
MED19 (596 words) [view diff] exact match in snippet view article find links to article
PMC 2631966. PMID 19049968. Li LH, He J, Hua D, Guo ZJ, Gao Q (2011). "Lentivirus-mediated inhibition of Med19 suppresses growth of breast cancer cells
Frataxin (2,709 words) [view diff] exact match in snippet view article find links to article
patient fibroblasts show increased levels of DNA double-strand breaks. A lentivirus gene delivery system was used to deliver the frataxin gene to the FRDA
ZNF350 (739 words) [view diff] exact match in snippet view article find links to article
Bulliard Y, Wiznerowicz M, Barde I, Trono D (Nov 2006). "KRAB can repress lentivirus proviral transcription independently of integration site". The Journal
Florida panther (3,954 words) [view diff] exact match in snippet view article find links to article
populations has shown evidence of feline immunodeficiency virus and puma lentivirus among certain individuals. The presence of these viruses is likely related
Decay-accelerating factor (956 words) [view diff] exact match in snippet view article find links to article
GH, Friedmann T (April 2005). "Baculovirus GP64-pseudotyped HIV-based lentivirus vectors are stabilized against complement inactivation by codisplay of
Hamilton, Montana (1,488 words) [view diff] exact match in snippet view article find links to article
has begun operations using highly-pathogenic organisms including the Lentivirus family of viruses. Hamilton is located at 46°14′54″N 114°9′35″W / 46
Luk Van Parijs (1,522 words) [view diff] exact match in snippet view article find links to article
Zhang M, McManus MT, Gertler FB, Scott ML, and van Parijs L (2003) A lentivirus-based system to functionally silence genes in primary mammalian cells
Transduction (genetics) (1,403 words) [view diff] exact match in snippet view article
viruses and lead to expression of the genes transferred and (in the case of lentivirus/retrovirus vectors) insertion of the DNA to be transferred into the cellular
Leukomyelitis (231 words) [view diff] exact match in snippet view article find links to article
Promoter Isolated from Multiple Tissues from a Sheep with Multisystemic Lentivirus-Associated Inflammatory Disease". Viruses. 5 (8): 2005–2018. doi:10.3390/v5082005
Michel Sadelain (2,138 words) [view diff] exact match in snippet view article find links to article
Sadelain Therapeutic haemoglobin synthesis in β-thalassaemic mice expressing lentivirus-encoded human β-globin, Nature 406, 82–86 (2000). [1] 2002- Maher, John;
Tetherin (2,265 words) [view diff] exact match in snippet view article find links to article
underscoring the role of BST-2 in HIV type 1 infection. Another primate lentivirus, SIV, also, counteracts tetherin by their removal from the plasma membrane
POLR2C (1,273 words) [view diff] exact match in snippet view article find links to article
1073/pnas.92.16.7153. PMC 41297. PMID 7638159. Herrmann CH, Rice AP (1995). "Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK
LAMP2 (2,098 words) [view diff] exact match in snippet view article find links to article
Molecular Immunology. 30 (4): 351–4. PMID 24721399. Li L, Li J (May 2015). "[Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple
RNA virus (3,772 words) [view diff] exact match in snippet view article find links to article
flavivirus supergroup; the dsRNA viruses; and the -ve strand viruses. The lentivirus group appears to be basal to all the remaining RNA viruses. The next major
Epidermolytic hyperkeratosis (1,610 words) [view diff] exact match in snippet view article find links to article
be used by other researchers. Most recently we've developed a special 'lentivirus reporter construct' in which we can see through changes in fluorescence
UC Davis School of Veterinary Medicine (1,643 words) [view diff] exact match in snippet view article find links to article
B. (1991-05-01). "Simian and feline immunodeficiency viruses: animal lentivirus models for evaluation of AIDS vaccines and antiviral agents". Antiviral
Stemgent (1,003 words) [view diff] exact match in snippet view article find links to article
Aldrich and Stemgent signed a worldwide distribution agreement to offer lentivirus-based delivery systems for the generation of induced pluripotent stem
POLR2G (1,119 words) [view diff] exact match in snippet view article find links to article
1073/pnas.92.16.7153. PMC 41297. PMID 7638159. Herrmann CH, Rice AP (1995). "Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK
POLR2L (1,035 words) [view diff] exact match in snippet view article find links to article
1128/mcb.15.9.4702. PMC 230713. PMID 7651387. Herrmann CH, Rice AP (1995). "Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK
POLR2J (1,216 words) [view diff] exact match in snippet view article find links to article
1073/pnas.92.16.7153. PMC 41297. PMID 7638159. Herrmann CH, Rice AP (1995). "Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK
POLR2H (986 words) [view diff] exact match in snippet view article find links to article
1128/mcb.15.9.4702. PMC 230713. PMID 7651387. Herrmann CH, Rice AP (1995). "Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK
POLR2E (1,162 words) [view diff] exact match in snippet view article find links to article
1995.tb06984.x. PMC 398061. PMID 7828586. Herrmann CH, Rice AP (1995). "Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK
Severe combined immunodeficiency (2,897 words) [view diff] exact match in snippet view article find links to article
recently in 2019 a new method using an altered version of the HIV virus as a lentivirus vector was reported in the treatment of 8 children with X-SCID, and in
RABAC1 (1,085 words) [view diff] exact match in snippet view article find links to article
2005). "PRA1 co-localizes with envelope but does not influence primate lentivirus production, infectivity or envelope incorporation". The Journal of General
POLR2K (1,059 words) [view diff] exact match in snippet view article find links to article
9.4702. PMC 230713. PMID 7651387. Herrmann CH, Rice AP (March 1995). "Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK
LifeAct Dye (745 words) [view diff] exact match in snippet view article find links to article
the analysis. LifeAct Plasmid LifeAct mRNA LifeAct Adenovirus LifeAct Lentivirus LifeAct Protein LifeAct-TagGFP2 being the most widely used dye compared
POLR2F (993 words) [view diff] exact match in snippet view article find links to article
doi:10.3109/10425179409020860. PMID 7803819. Herrmann CH, Rice AP (1995). "Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK
POLR2I (956 words) [view diff] exact match in snippet view article find links to article
1073/pnas.92.16.7153. PMC 41297. PMID 7638159. Herrmann CH, Rice AP (1995). "Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK
Small interfering RNA (5,632 words) [view diff] exact match in snippet view article find links to article
vectors based on retrovirus, adeno-associated virus, adenovirus, and lentivirus. The latter is the most efficient virus that stably delivers siRNA to
Virotherapy (3,468 words) [view diff] exact match in snippet view article find links to article
are extracted and engineered with a virus typically gammaretrovirus or lentivirus to recognize specific proteins on cell surfaces. This causes the T-lymphocytes
Genome-wide CRISPR-Cas9 knockout screens (6,102 words) [view diff] exact match in snippet view article find links to article
vector backbone design; (iv) producing sufficient amounts of high-quality lentivirus; (v) overcoming low transformation efficiency; (vi) proper scaling of
RNA polymerase II subunit B4 (1,013 words) [view diff] exact match in snippet view article find links to article
1073/pnas.92.16.7153. PMC 41297. PMID 7638159. Herrmann CH, Rice AP (1995). "Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK
Janet K. Yamamoto (907 words) [view diff] exact match in snippet view article find links to article
immunodeficiency virus infection in cats. (1988) Feline T-lymphotropic lentivirus assay (1992) Dual-subtype FIV vaccine (Fel-O-Vax® FIV) protection against
Dendrocyte expressed seven transmembrane protein (575 words) [view diff] exact match in snippet view article find links to article
molimm.2010.04.019. PMID 20546900. Zeng Z, Zhang C, Chen J (July 2013). "Lentivirus-mediated RNA interference of DC-STAMP expression inhibits the fusion and
COVID-19 vaccine (29,666 words) [view diff] exact match in snippet view article find links to article
virus-like particle vaccines, multiple DNA plasmid vaccines, at least two lentivirus vector vaccines, a conjugate vaccine, and a vesicular stomatitis virus
Hit selection (1,695 words) [view diff] exact match in snippet view article find links to article
Arthur WT, Lacson R, Zhang XH, Ferrer M, Moon RT, Cleary MA (2010). "A lentivirus-mediated genetic screen identifies dihydrofolate reductase (DHFR) as a
Adoptive cell transfer (4,004 words) [view diff] exact match in snippet view article find links to article
Lymphoma CD19 1 100% First use of anti-CD19 CAR 2011 CLL CD19 3 100% Lentivirus used for transduction 2013 ALL CD19 5 100% Four of five then underwent
David Baltimore (8,197 words) [view diff] exact match in snippet view article find links to article
early 2000s one of Baltimore's graduate students, Lili Yang, developed a lentivirus vector that allowed for the cloning of genes for two chains of TCR. Recognizing
Klaus Cichutek (996 words) [view diff] exact match in snippet view article find links to article
Cichutek K. Dev Biol (Basel). 2000; 104:53-6. PMID 11713824 A novel lentivirus vector derived from apathogenic simian immunodeficiency virus. Stitz J
RNA silencing (5,312 words) [view diff] exact match in snippet view article find links to article
capsid pseudotyping/engineering facilitates specific cell-targeting Lentivirus Up to 13.5 Kb RNA vector, integration competent and incompetent forms
Plasmablastic lymphoma (2,950 words) [view diff] exact match in snippet view article find links to article
Patients Using Peripheral Blood Stem/Progenitor Cells Treated with a Lentivirus Vector-Encoding Multiple Anti-HIV RNAs". 15 February 2021. Cite journal
Beatrice Hahn (2,149 words) [view diff] exact match in snippet view article find links to article
chimpanzees may be source of HIV-1 began when a chimpanzee was found to have a lentivirus (SIVcpzGAB1) that was closely related to HIV-1. The genome of SIVcpzGAB1
TEX9 (1,177 words) [view diff] exact match in snippet view article find links to article
CTGGTATGTAGTATAGTGCCA - and - Homeodomain protein NKX3.2 ACTGTGAAGTGGGCACTAT + Lentivirus LTR TATA box CCATATAACTGGTAAGT + Cdx-2 mammalian caudal related intestinal
Pierre Charneau (885 words) [view diff] exact match in snippet view article find links to article
structure within the HIV genome and its key function in nuclear import of the lentivirus/HIV genome in non-dividing cells. This discovery enabled the development
CUL4A (4,395 words) [view diff] exact match in snippet view article find links to article
appears to utilize CRL4ADCAF1 via Vpx protein-induced destruction of a lentivirus-inhibiting deoxynucleoside triphosphohydrolase named SAMHD1. In 2010,
Epigenetics and melanoma (2,912 words) [view diff] exact match in snippet view article find links to article
and invasive ability of melanoma by inactivation of mutated BRAF with lentivirus-mediated RNA interference”. Oncogene, Vol 23:6031–9. Eskandarpour, M.
Strictly standardized mean difference (3,525 words) [view diff] exact match in snippet view article find links to article
Zhang XHD, Ferrer M, Moon RT, Cleary MA (2010). Bereswill S (ed.). "A lentivirus-mediated genetic screen identifies dihydrofolate reductase (DHFR) as a
William A. Haseltine (11,663 words) [view diff] exact match in snippet view article find links to article
foreign genes into cells, laying the foundation for what are now called "lentivirus vectors for gene therapy". The laboratory also created hybrid viruses
ZNF337 (2,706 words) [view diff] exact match in snippet view article find links to article
ctatagtTAAGaacaat Avian C-type LTR TATA box   743 0.825 ttttattTAGGtagccc Lentivirus LTR TATA box 314 0.83 gtgTATAatatgctgat Cellular and viral TATA box elements
Death regulator Nedd2-like caspase (4,775 words) [view diff] exact match in snippet view article find links to article
(December 2013). "Apoptotic block in colon cancer cells may be rectified by lentivirus mediated overexpression of caspase-9". Acta Gastro-Enterologica Belgica