Find link

language:

jump to random article

Find link is a tool written by Edward Betts.

Longer titles found: Factor XI (view), Factor XII (view), Factor XIII (view), Factor XIII deficiency (view), Factor XII deficiency (view), Factor X (Chilean TV series) (view), Factor X (Chilean season 1) (view), Factor X (Portuguese TV series) (view), Factor X (Spanish TV series) (view), Factor X (disambiguation) (view), Factor X deficiency (view), El Factor X (view), Translin-associated factor X (view)

searching for Factor X 238 found (346 total)

alternate case: factor X

RFX6 (472 words) [view diff] exact match in snippet view article find links to article

Regulatory factor X, 6 also known as DNA-binding protein RFX6 is a protein that in humans is encoded by the RFX6 gene. The nuclear protein encoded by this
RFX3 (613 words) [view diff] exact match in snippet view article find links to article
humans is encoded by the RFX3 gene. This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved
RFX2 (695 words) [view diff] exact match in snippet view article find links to article
humans is encoded by the RFX2 gene. This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved
RFX4 (659 words) [view diff] exact match in snippet view article find links to article
humans is encoded by the RFX4 gene. This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly
RFXANK (1,203 words) [view diff] exact match in snippet view article find links to article
immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds
Age of Apocalypse (9,003 words) [view diff] exact match in snippet view article find links to article
X-Ternals, Generation Next, Astonishing X-Men, Amazing X-Men, Weapon X, Factor X, X-Man and X-Universe. The event was bookended by two one shots, X-Men
MAX (gene) (2,344 words) [view diff] exact match in snippet view article
MAX (also known as myc-associated factor X) is a gene that in humans encodes the MAX transcription factor. The protein product of MAX contains the basic
Principal bundle (2,958 words) [view diff] no match in snippet view article find links to article
X} . For a product space, this is just the projection onto the first factor, ( x , g ) ↦ x {\displaystyle (x,g)\mapsto x} . Unlike a product space, principal
Chocolate agar (230 words) [view diff] exact match in snippet view article find links to article
such as nicotinamide adenine dinucleotide (factor V or NAD) and hemin (factor X), which are inside red blood cells; thus, a prerequisite to growth for
RFX5 (1,207 words) [view diff] exact match in snippet view article find links to article
0.CO;2-H. PMID 9401005. "Entrez Gene: RFX5 regulatory factor X, 5 (influences HLA class II expression)". Hake SB, Masternak K, Kammerbauer
X-Factor (comics) (3,908 words) [view diff] case mismatch in snippet view article
several times with different team rosters, most recently as All-New X-Factor. X-Factor launched in 1986, featuring the five original X-Men reorganizing
Factor theorem (727 words) [view diff] case mismatch in snippet view article find links to article
factor theorem states that a polynomial f ( x ) {\displaystyle f(x)} has a factor ( x − k ) {\displaystyle (x-k)} if and only if f ( k ) = 0 {\displaystyle
Red Uno de Bolivia (69 words) [view diff] exact match in snippet view article find links to article
main competitor. Its most notable programming is Notivision (news) and "Factor X Bolivia". "Country profile: Bolivia". August 2, 2012 – via news.bbc.co
Chris McCarvill (1,191 words) [view diff] exact match in snippet view article find links to article
landed a full-time job as a graphic artist. He joined heavy metal band X Factor X, and continued to write with Polivka. During this time, Chris taught himself
Siam (duo) (525 words) [view diff] exact match in snippet view article
Carolina Nuñez, they are married. In 2009, they won the third series of El factor X, the Colombian edition of The X Factor. They were mentored by Jose Gaviria
Skids (character) (2,776 words) [view diff] no match in snippet view article
Skids (Sally Blevins) is a fictional mutant character appearing in American comic books published by Marvel Comics. Created by writer Louise Simonson and
Caliban (Marvel Comics) (2,750 words) [view diff] no match in snippet view article
was originally a member of the Morlocks. He was also a member of the X-Factor, X-Men, X-Force and The 198. He was chosen twice by Apocalypse as one of
Arcade (Marvel Comics) (4,204 words) [view diff] no match in snippet view article
Marvel heroes, often focusing on the X-Men and associated members of X-Factor, X-Force and Excalibur. In what is considered the "game changer" for Arcade
La Oreja de Van Gogh (1,332 words) [view diff] exact match in snippet view article find links to article
followed in September 2008. Leire was discovered on the Spanish reality show Factor X. The band was formed under the provisional name Los Sin Nombre (The Nameless)
RFX1 (1,436 words) [view diff] exact match in snippet view article find links to article
short arm of chromosome 19. The RFX1 gene is a member of the regulatory factor X (RFX) gene family, which encodes transcription factors that contain five
Julio César Meza (107 words) [view diff] exact match in snippet view article find links to article
of The X Factor entitled El factor X broadcast on RCN TV. He went platinum with his first release after winning El factor X.[citation needed] 2006: Luchando
María Villalón (392 words) [view diff] exact match in snippet view article find links to article
of seventeen when she auditioned for the reality show music competition Factor X, the Spanish version of The X Factor, aired on Cuatro. She went on to win
Scherrer equation (3,247 words) [view diff] no match in snippet view article find links to article
The Scherrer equation, in X-ray diffraction and crystallography, is a formula that relates the size of sub-micrometre crystallites in a solid to the broadening
Inferno (Marvel Comics) (3,380 words) [view diff] no match in snippet view article
1989 that mainly involved the mutant titles, namely Uncanny X-Men, X-Factor, X-Terminators, Excalibur, and The New Mutants. The story concerned the corruption
RFXAP (909 words) [view diff] exact match in snippet view article find links to article
Regulatory factor X-associated protein is a protein that in humans is encoded by the RFXAP gene. Major histocompatibility (MHC) class II molecules are
Francisco Villarreal (155 words) [view diff] exact match in snippet view article find links to article
Villarreal is a Colombian singer. In 2006, he won the second series of El factor X, the Colombian edition of The X Factor. He beat runner-up Mario Marcelino
Ídolos (Portuguese TV series) (921 words) [view diff] exact match in snippet view article
since late 2012, since then their timeslot for 2013 has been taken over by Factor X, the Portuguese version of The X Factor. In the first and second season:
Zeta Bosio (836 words) [view diff] exact match in snippet view article find links to article
Chilean channel Via X. In 2011, he was a judge in the Chilean TV show Factor X. Bosio began his contact with music at age 11, when he first heard The
The X Factor (British series 8) (7,216 words) [view diff] case mismatch in snippet view article
'The X Factor' – X Factor News – TV". Digital Spy. 23 October 2011. Retrieved 11 November 2011. "Sophie Habibis voted out of 'The X Factor' – X Factor
Floating rate note (907 words) [view diff] no match in snippet view article find links to article
value of the FRN. Deleveraged FRN = long pure FRN + short (1 - leverage factor) x swap A leveraged or super floater gives the investor increased exposure
Material input per unit of service (1,356 words) [view diff] exact match in snippet view article find links to article
products are needed to produce the service for greater number of people. The Factor X concept was coined by Prof. Friedrich Schmidt-Bleek. The factor targets
Vocal Tempo (70 words) [view diff] exact match in snippet view article find links to article
Vocal Tempo is a Cuban vocal group that won in 2008 the second series of Factor X, the Spanish version of The X Factor. The music contest was broadcast on
List of programs broadcast by MundoMax (445 words) [view diff] exact match in snippet view article find links to article
(March 18, 2013) Minuto Para Ganar (August 13, 2012 – November 30, 2016) El Factor X (July 29, 2013 – September 2016) Protagonistas de Nuestra Tele (2013) Noticias
Marbelle (433 words) [view diff] exact match in snippet view article find links to article
Latin American countries. She is also known as judge and mentor in El factor X and the children spin-off El factor Xs. Daughter of a police officer, she
Mycobacterium haemophilum (259 words) [view diff] exact match in snippet view article find links to article
Physiology Media have to be supplemented with 0.4% haemoglobin or 60 μM hemin (factor X) or 15 mg/ml ferric ammonium citrate respectively, but not with FeCl3 or
Recurrent word (419 words) [view diff] exact match in snippet view article find links to article
A uniformly recurrent word is a recurrent word in which for any given factor X in the sequence, there is some length nX (often much longer than the length
Paolo Ramírez (529 words) [view diff] exact match in snippet view article find links to article
the series Rojo Fama Contrafama and in 2011, he came fifth in Chilean Factor X. He is one of the contestants on the American reality television series
Eva Perales (94 words) [view diff] exact match in snippet view article find links to article
events, both in Spain and overseas. In 2007 and 2008, she was a judge on Factor X, the Spanish version of The X Factor. In 2011, she was also a judge on
Mir-346 microRNA precursor family (657 words) [view diff] exact match in snippet view article find links to article
(December 2011). "The unfolded protein response (UPR)-activated transcription factor X-box-binding protein 1 (XBP1) induces microRNA-346 expression that targets
Quizás Debió Llover (75 words) [view diff] exact match in snippet view article find links to article
The song was released during broadcasting of the final episode of El Factor X, winning that night the first place. Album version "Quizás Debió Llover"
Phalanx Covenant (499 words) [view diff] exact match in snippet view article find links to article
September – October 1994 Genre Superhero Crossover Main character(s) X-Men X-Factor X-Force Excalibur Creative team Writer(s) (Cable, Wolverine) Larry Hama (Excalibur
Weapon X (5,314 words) [view diff] exact match in snippet view article find links to article
Gambit and the X-Ternals #1–2, Weapon X (Vol. 1) #1–2, Amazing X-Men #1–2, Factor X #1–2, and X-Man #1 August 2006 0785122648 X-Men: The Complete Age Of Apocalypse
Valerie Cooper (1,069 words) [view diff] case mismatch in snippet view article find links to article
ISBN 978-1-4654-7890-0. X-Factor Annual #7 (1992) X-Factor vol. 3 #233 John Walker: U.S. Agent#4 Factor-X #1-4 (March–June 1995) Ultimate Fallout #4 (2011)
Steve Epting (1,574 words) [view diff] no match in snippet view article find links to article
franchise of X-Men titles including the "Age of Apocalypse" crossover and Factor-X, the alternate timeline counterparts of X-Factor. He had a run on the X-Factor
Tito Beltrán (877 words) [view diff] exact match in snippet view article find links to article
jurado de Factor X." La Tercera (in Swedish). Retrieved 12 January 2011. "Tito Beltrán y Karen Doggenweiler se suman al jurado de "Factor X"". Emol (in
Marker (TV series) (158 words) [view diff] exact match in snippet view article
Hawaii" Kristoffer Tabori Stephen J. Cannell May 2, 1995 (1995-05-02) 12 "Factor X" Andrew Stevens Philip DeGuere May 9, 1995 (1995-05-09) 13 "Discovery"
Julián Elfenbein (354 words) [view diff] exact match in snippet view article find links to article
return to the network as host of the first-ever series of Chilean version Factor X of the international The X Factor, and host of Un minuto para ganar, the
Main effect (1,248 words) [view diff] exact match in snippet view article find links to article
restaurants. Let taste testers rank the chicken from 1 to 10 (best tasting), for factor X: "spiciness" and factor Y: "crispiness." Level X1 is for "not spicy" chicken
Carboxyglutamic acid (651 words) [view diff] case mismatch in snippet view article find links to article
found to partially mediate the binding of factor IXa to platelets and in factor-X activation. In addition, upon mechanical injury to the blood vessel wall
Factorization (7,596 words) [view diff] case mismatch in snippet view article find links to article
4x^{2}+20x+3xy+15y,} one may remark that the first two terms have a common factor x, and the last two terms have the common factor y. Thus 4 x 2 + 20 x + 3
Vicky Funari (109 words) [view diff] exact match in snippet view article find links to article
alongside Sergio De La Torre in collaboration with the women of Grupo Factor X, Colectivo Chilpancingo, and Promotoras por los Derechos de las Mujeres
Slave Pit Inc. (336 words) [view diff] exact match in snippet view article find links to article
1993 First Gwar-B-Que at the Slave Pit. Gwar Death Piggy Mensrea Locus Factor X-Cops Dave Brockie Experience DRT Entertainment Shimmy Disc Metal Blade
Dealema (491 words) [view diff] exact match in snippet view article find links to article
from Porto and Vila Nova de Gaia. Began with the merger of two projects: Factor X that had Mundo Segundo and DJ Guze and Mike, and Fullashit, in which were
Shihab Shaheen (1,893 words) [view diff] case mismatch in snippet view article find links to article
television serial, Romijer Ayna in 2005. His notable telefilm works include X-Factor, X-Factor 2, Bhalobashi Tai, Bhalobashi Tai Bhalobeshe Jai, Monforing er
Mutant (Marvel Comics) (2,260 words) [view diff] exact match in snippet view article
Jack Kirby Characteristics Place of origin Earth Notable members X-Men X-Factor X-Force Dark X-Men New Mutants Brotherhood of Mutants Acolytes Morlocks Quiet
Belinda Peregrín (3,136 words) [view diff] exact match in snippet view article find links to article
July 2019. "Belinda, Chino y Nacho y Angélica María serán jueces de El Factor X, por MundoFox". People en Español. Retrieved 30 July 2019. "'La Voz' de
Nate Grey (7,780 words) [view diff] exact match in snippet view article find links to article
Gambit and the X-Ternals #1-2, Weapon X #1-2, Amazing X-Men #1-2, and Factor X #1-2 August 9, 2006 0785122648 X-Men: The Complete Age of Apocalypse Epic
Mutant Massacre (1,255 words) [view diff] exact match in snippet view article find links to article
Uncanny X-Men #211 New Mutants #46 Uncanny X-Men #212 Uncanny X-Men #213 X-Factor X-Factor #9 (Prologue) X-Factor #10 Thor #373 Power Pack #27 Thor #374 X-Factor
Gregory Allen Howard (778 words) [view diff] exact match in snippet view article find links to article
combat in World War II. Howard has also written the screenplay for the film Factor X, which will be produced by Ridley Scott and star Eric Bana. In Spring 2014
Olu Dara (730 words) [view diff] exact match in snippet view article find links to article
(Silkheart) 1987 Worshippers Come Nigh (Silkheart) With Rhys Chatham 1984 Factor X 1987 Die Donnergötter (The Thundergods) With Carlos Garnett 1975 Let This
Bedlam (comics) (1,234 words) [view diff] exact match in snippet view article
into a bus. X-Force vol. 1 #87 X-Force vol. 1 #115 X-Force vol. 1 #102 Factor X #1 Megan Peters (March 22, 2018). "'Deadpool 2' Trailer Confirms Terry
Mon Laferte (2,590 words) [view diff] exact match in snippet view article find links to article
judge the second season of the Chilean version of The X Factor, called Factor X, along with Karen Doggenweiler, Tito Beltrán and José Luis Rodríguez. It
Place on Earth (75 words) [view diff] case mismatch in snippet view article find links to article
(2018) Square (2018) "Blachmans totale triumf: Place on Earth vinder X Factor | X Factor". DR. Retrieved 2018-04-07. Place on Earth on Facebook Place on
Scott syndrome (790 words) [view diff] exact match in snippet view article find links to article
Bevers EM, Comfurius P, Hemker HC, von Dieijen G, Weiss HJ, et al. Impaired factor X and prothrombin activation associated with decreased phospholipid exposure
Angélica María (2,869 words) [view diff] exact match in snippet view article find links to article
Marcada 1989: Tres generaciones 2008–2010: Angélica María Show 2013–2014: El Factor X 2016: Graves 1982: 'To Kill a Stranger as Christina Carver 2003: 'Sea of
Astonishing X-Men (7,831 words) [view diff] exact match in snippet view article find links to article
Gambit and the X-Ternals #1–2, Weapon X (vol. 1) #1–2, Amazing X-Men #1–2, Factor X #1–2, and X-Man #1 376 August 9, 2006 0785122648 X-Men: The Complete Age
ARID2 (1,382 words) [view diff] exact match in snippet view article find links to article
rich in the amino acid residues proline and glutamine, a RFX (regulatory factor X)-type winged-helix DNA-binding domain, and a conserved N-terminal AT-rich
María Elisa Camargo (756 words) [view diff] exact match in snippet view article find links to article
"El Baron", where she starred as Isabel. In 2005 she auditioned for El factor X (Colombia's version of The X Factor). After several months of auditions
Backlash (2001) (1,734 words) [view diff] case mismatch in snippet view article
performed a Litasault on Molly to win the match. The event opened with X-Factor (X-Pac, Justin Credible and Albert) facing The Dudley Boyz (Bubba Ray Dudley
X Factor (Danish season 11) (847 words) [view diff] case mismatch in snippet view article
by X Factor 2018 auditionees) "Danmarks bedste tv-vært er tilbage i X Factor | X Factor | DR" (in Danish). Retrieved September 21, 2017. "X Factor ny sæson
World Archery Rankings (586 words) [view diff] no match in snippet view article find links to article
example above would receive the following Ranking Score: 1.125 ("Ranking Factor") x 12 ("Ranking Points": 4th place) = 13.5 A team or competitor's best four
Henry Peter Gyrich (2,233 words) [view diff] exact match in snippet view article find links to article
ISBN 0-7851-4076-X) (2010) Captain America #12–13 Captain Marvel Vol. 9 #6 Factor X #1 Mutant X #26 (December 2000) Ultimate Spider-Man #100 Ultimate Spider-Man
John Francis Moore (writer) (368 words) [view diff] exact match in snippet view article
Avengers Annual '99 Doom 2099 #1-8, 10-15, 17-25, 43-44 (1993–1995, 1996) Factor X #1-4 (1995) Fantastic Four vol. 3 #33-34 (2000) Marvel Comics Presents
Super Lap Battle (385 words) [view diff] exact match in snippet view article find links to article
2010 event by Sierra Sierra Enterprises' Mitsubishi Lancer Evolution and Factor X Motorsports Development's Acura NSX, muscling their way to lap times of
Shannon Tweed (1,098 words) [view diff] exact match in snippet view article find links to article
Lake Season 11 episode 15: "Twice Dead" Marker Samantha Kent Episode 12: "Factor X" 1995–2001 Frasier Dr. Honey Snow Season 2 episode 15: "You Scratch My
Amblyomma cajennense (320 words) [view diff] exact match in snippet view article find links to article
In August 2009, Brazilian researchers announced that a protein called Factor X active found in the saliva of the tick proved effective in stopping the
List of Colombian television series (826 words) [view diff] exact match in snippet view article find links to article
Robinson (2001–2002) Tengo una Ilusión (2005–2006) El Aprendiz (2005) El factor X (2005–present) Los Reyes de la Pista (2006) Yo me llamo (2011–2012) Dejémonos
Metabotropic glutamate receptor 4 (1,762 words) [view diff] exact match in snippet view article find links to article
interaction of the nuclear matrix protein C1D with Translin-associated factor X (TRAX)". Journal of Cell Science. 115 (Pt 1): 207–16. doi:10.1242/jcs.115
X-Men: Messiah Complex (2,032 words) [view diff] no match in snippet view article find links to article
the X-Men no longer being a team, and encompassed the Uncanny X-Men, X-Factor, X-Force, Young X-Men, X-Men: Legacy, Wolverine, and Cable ongoing series
Havok (comics) (8,039 words) [view diff] exact match in snippet view article
Giant Size X-Men 1 (May 1975), Marvel Comics Factor X #01 Tales of the Age of Apocalypse: By the Light Factor X #04 X-Men: Omega Uncanny Avengers #8AU (July
Judgment Day (2001) (2,127 words) [view diff] case mismatch in snippet view article
Bubba following a Clothesline From Hell. The APA were eliminated by X-Factor (X-Pac and Justin Credible) after Albert tripped Bradshaw, allowing X-Pac
Bragg's law (2,467 words) [view diff] exact match in snippet view article find links to article
Henderson limit Laue conditions Powder diffraction Radar angels Structure factor X-ray crystallography Bragg, W. H.; Bragg, W. L. (1913). "The Reflexion of
Auryn (870 words) [view diff] exact match in snippet view article find links to article
members of the band have taken part at different occasions in contests like Factor X, Veo Veo, La Batalla de los Coros and at Junior Eurovision Song Contest
Karen Doggenweiler (344 words) [view diff] exact match in snippet view article find links to article
(2010) Pelotón V (2010) Animal Nocturno (2010-2011) Mamá a los 15 (2011-) Factor X (2011-) Dime por qué? (2011) La dieta del Lagarto (2011) http://diario
What The--?! (329 words) [view diff] no match in snippet view article find links to article
Gauntlet December 1992 25 Mutant parody issue The X-Men, the New Mutants, X-Factor, X-Force Summer 1993 26 Spider-Ham 15.88 Spider-Man 2099 Winter 1993
Avalanche (character) (2,481 words) [view diff] exact match in snippet view article
Vol. 2 #22. Marvel Comics. Uncanny X-Men #16 (Apr 2019). Marvel Comics. Factor X #1. Marvel Comics. Marvel Zombies: Dead Days #1. Marvel Comics. House of
Dennis Rader (5,839 words) [view diff] no match in snippet view article find links to article
folk song "O Death". In the letter, he claimed to be driven to kill by "factor X", which he characterized as a supernatural element that also motivated
Segmented regression (1,411 words) [view diff] case mismatch in snippet view article find links to article
abrupt change of the response function (Yr) of a varying influential factor (x). The breakpoint can be interpreted as a critical, safe, or threshold
Plus (Slovak TV channel) (65 words) [view diff] exact match in snippet view article
Friday & Saturday 8:15-9:15 PM live episodes unaired 576i (SDTV) The X Factor X Factor 1 Friday 8:15-10:15 PM (performance show), 10:15-11:00 PM (results
Butterjack (1,543 words) [view diff] case mismatch in snippet view article find links to article
2010. Retrieved 25 November 2010. "Katie 'could be asked to leave X Factor' – X Factor News – Reality TV – Digital Spy". Digitalspy.co.uk. 3 November
Doubling the cube (1,777 words) [view diff] case mismatch in snippet view article find links to article
seen to be irreducible over ℤ – any factorisation would involve a linear factor (x − k) for some k ∈ ℤ, and so k must be a root of p(x); but also k must
Polynomial long division (2,208 words) [view diff] case mismatch in snippet view article find links to article
remainder must be zero. Likewise, if more than one root is known, a linear factor (x − r) in one of them (r) can be divided out to obtain Q(x), and then a
Obsession (band) (314 words) [view diff] exact match in snippet view article
Soto, House of Lords, MVP, Dokken, Eddie Ojeda, Dr. Sin, D-Metal Stars, X Factor X Website Official site Members Michael Vescera John Bruno Scott Boland Jeff
Tibor Kocsis (72 words) [view diff] no match in snippet view article find links to article
over other finalist and eventual runner-up Enikő Muri. Hungarian pop X Factor: X-Faktor 2. – Finálé (in Hungarian) Tibor Kocsis official Facebook page
TV JOJ (919 words) [view diff] exact match in snippet view article find links to article
TBA 1 rumoured TBA Transporter: The Series Kuriér 1 cancelled TBA The X Factor X Factor (USA) 3 Live shows on JOJ Plus TBA Homeland TBA 1 rumoured TBA MacGyver
Stefano Sollima (847 words) [view diff] no match in snippet view article find links to article
Variety. Retrieved 30 May 2018. "Argentero nel video di Francesca (X-Factor)" [X-Factor: Luca Argentero in Francesca's Music Video]. ANSA (in Italian)
João Manzarra (361 words) [view diff] exact match in snippet view article find links to article
SIC 19 Anos - Parabéns a Você 2011: Natal Portugal 2012: Ídolos 2013: Factor X Sapo.pt: João Manzarra: o menino-prodígio da SIC (in Portuguese) João Manzarra
Sweden–United Kingdom relations (3,163 words) [view diff] case mismatch in snippet view article find links to article
television, have been broadcast in Sweden, including Pop Idol (Idol), The X Factor (X Factor), I'm a Celebrity...Get Me Out of Here! (Kändisdjungeln), MasterChef
Terry Dodson (1,651 words) [view diff] exact match in snippet view article find links to article
One Volume 1 (with Jeff Lemire, 2014) Age of Apocalypse (Marvel, 1995): Factor X #3-4 (with John Francis Moore and Steve Epting, 1995) X-Universe #2 (with
Eisenstein's criterion (3,565 words) [view diff] case mismatch in snippet view article find links to article
polynomial is obtained by dividing the polynomial xp − 1 by the linear factor x − 1, corresponding to its obvious root 1 (which is its only rational root
X of Swords (2,097 words) [view diff] case mismatch in snippet view article find links to article
ComicBookRoundUp.com". Comic Book Roundup. Retrieved October 13, 2020. For X-Factor: "X-Factor (2020) Comic Series Reviews at ComicBookRoundUp.com". Comic Book
Eulerian number (2,100 words) [view diff] no match in snippet view article find links to article
be written in a somehow more compact form by means of an integrating factor: ( x − 1 ) − 2 n − 2 P n + 1 ( x ) = ( x ( 1 − x ) − 2 n − 1 P n ( x ) ) ′
Pyro (Marvel Comics) (3,058 words) [view diff] exact match in snippet view article
Archived from the original on 17 August 2018. Retrieved 17 August 2018. Factor X #1 Incredible Hulk vol. 2 #83-85 Marvel Zombies vs Army of Darkness #2
George E. Lewis (2,633 words) [view diff] exact match in snippet view article find links to article
1981) John Lindberg Trio, Give and Take (Black Saint, 1982) Rhys Chatham, Factor X (Moers, 1983) Joelle Leandre, Les Douze Sons (NATO, 1985) Ushio Torikai
Bare lymphocyte syndrome type II (863 words) [view diff] exact match in snippet view article find links to article
3(cytogenetic location) RFXANK(also known as ankyrin repeat-containing regulatory factor X-associated protein) has the same function(as the other genes) and is located
Sean Kanan (1,452 words) [view diff] case mismatch in snippet view article find links to article
Emmy-nominated series “Studio City” and the co-compilation of a new book, Success Factor x published by Plain Sight Publishing. It rapidly became a best seller on
Square–cube law (1,768 words) [view diff] case mismatch in snippet view article find links to article
{F}{A}}=M{\frac {a}{A}}} . Now, consider the object be exaggerated by a multiplier factor = x so that it has a new mass, M ′ = x 3 M {\displaystyle M'=x^{3}M} , and
Galvanic anode (1,878 words) [view diff] case mismatch in snippet view article find links to article
Mass = (Current Required x Design Life x 8760) ÷ (Utilisation Factor x Anode Capacity) (5)
Nadia Afrin Mim (209 words) [view diff] exact match in snippet view article find links to article
Beautiful Ahdunik Chele Shuddho Mokled Super Girls Megher Pore Megh Jomese X-Factor X-Factor Reload Chonnochara Bideshi Para Hawai Mithai (2020) Tibbet Pran
Quicksilver (Marvel Comics) (7,500 words) [view diff] exact match in snippet view article
(retconned) Team affiliations Avengers Brotherhood of Mutants Inhumans X-Factor X-Men Partnerships Scarlet Witch Notable aliases Pietro Frank, Mateo Maximoff
Ellipsoid (5,247 words) [view diff] no match in snippet view article find links to article
}}^{-1}(\mathbf {x} -{\boldsymbol {\mu }})^{\mathsf {T}}\right)} where k is a scale factor, x is an n-dimensional random row vector with median vector μ (which is also
Aurora (comics) (3,195 words) [view diff] case mismatch in snippet view article
(Vol. 5) #2 X-Factor (2020) #1 Alpha Flight #1 (1983) X-Factor #5 (2020) Factor-X #2 (1995) X-Men: Age of Apocalypse #2 (May 2005) Marvel Comics Marvel Zombies:
Blob (comics) (4,657 words) [view diff] exact match in snippet view article
(2014) X-Factor #107 Uncanny X-Men #7 Daredevil Vol. 1 #269 X-Men: Alpha Factor X #1 X-Men: Age of Apocalypse #6 Uncanny X-Force #12 Uncanny X-Force #15
Rhys Chatham (1,594 words) [view diff] exact match in snippet view article find links to article
2010, and Outdoor Spell, released in March 2011 by Northern Spy Records. Factor X (LP), Moers Music 1983 containing: For Brass (1982) Guitar Ring (1982)
Augustin Pyramus de Candolle (3,248 words) [view diff] exact match in snippet view article find links to article
Despite these findings, a number of scientists continued to search for "factor X", an unknown exogenous factor associated with the earth's rotation that
Stadiametric rangefinding (953 words) [view diff] case mismatch in snippet view article find links to article
cm) -- stadia factor 1000 10 milliradians ≈ 0.280" (0.711 cm) -- stadia factor x 100 100 milliradians ≈ 2.80" (7.112 cm) -- stadia factor x10 The approximate
Safe (Westlife song) (1,515 words) [view diff] case mismatch in snippet view article
on 2010-10-08. Retrieved 2010-10-07. "Take That, Westlife, JLS for 'X Factor' - X Factor News - TV". Digital Spy. 2010-11-01. Retrieved 2011-08-16. Safe
Asymptote (4,490 words) [view diff] case mismatch in snippet view article find links to article
{\displaystyle |x|\leq 1,|y|\leq 1} , but its highest order term gives the linear factor x with multiplicity 4, leading to the unique asymptote x=0. The hyperbola
Self-Indication Assumption Doomsday argument rebuttal (2,588 words) [view diff] no match in snippet view article find links to article
information that we have been born and that we are nth in line: For any factor, x << ( Ω {\displaystyle \Omega } / n), of the current population: lim Ω
Al Milgrom (2,965 words) [view diff] no match in snippet view article find links to article
#45–46 (inker) (1977, 1981) Excalibur #21–22, 25, 30–31, 35–36 (1990–1991) Factor-X #1–4 (1995) Fantastic Five #1–5 (1999–2000) Fantastic Four #208 (inker)
Self-Indication Assumption Doomsday argument rebuttal (2,588 words) [view diff] no match in snippet view article find links to article
information that we have been born and that we are nth in line: For any factor, x << ( Ω {\displaystyle \Omega } / n), of the current population: lim Ω
List of superhero teams and groups (1,528 words) [view diff] exact match in snippet view article find links to article
Thunderbolts Secret Warriors Thundercats Ultimates West Coast Avengers X-Factor X-Factor Investigations X-Force X-Statix X-Men X-Men 2099 Uncanny X-Men Young
Uncanny X-Men (5,492 words) [view diff] exact match in snippet view article find links to article
#20, X-Men Alpha, Amazing X-Men #1–4, Astonishing X-Men (vol. 2) #1–3, Factor X #1–4, Gambit & the X-Ternals #1–4, Generation Next #1–4, Weapon X #1–4
Pop (Slovenian TV channel) (4,283 words) [view diff] no match in snippet view article
season of the Slovenian version of the popular singing competition show X Factor, X Faktor Slovenija (2012). In the same year, the new original reality cooking
Cannonball (Marvel Comics) (4,345 words) [view diff] exact match in snippet view article
Avengers #12 Uncanny X-Men #341 (February 1997) X-Force #9 (July 1993) Factor X vol. 1 #4 Cable vol. 2 #4 The Last Avengers Story #1-2 (November 1995)
Artie Maddicks (853 words) [view diff] exact match in snippet view article find links to article
affiliations Future Foundation Generation X Daydreamers X-Terminators X-Factor X-Mansion Abilities Depowered, formerly: Ability to telepathically project
Polaris (Marvel Comics) (5,679 words) [view diff] exact match in snippet view article
X-Men: The Hidden Years #18, 2001 Uncanny X-Men #278 X-Men Legacy #259 Factor X #1-4 Civil War: House of M #2 House of M #1-8 Mutant X #32 Ultimate X-Men
External validity (3,874 words) [view diff] exact match in snippet view article find links to article
increasing external validity that is commonly ascribed to them. If background factor X treatment interactions exist of which the researcher is unaware (as seems
Plasma parameters (2,235 words) [view diff] case mismatch in snippet view article find links to article
Barry N.; Tiesenga, E. (20 May 2019). "CODATA Energy conversion factor: Factor x for relating K to eV". The NIST Reference on Constants, Units, and Uncertainty
DDRMAX Dance Dance Revolution 6thMix (2,129 words) [view diff] no match in snippet view article find links to article
Reveng vs De-Sire New Konami Original "Wild Rush (From Nonstop Megamix)" Factor-X New Konami Original Boss songs (2 total) "革命" (Kakumei) DJ Taka with Naoki
Events from the Modern Age of Comic Books (2,360 words) [view diff] no match in snippet view article find links to article
(Avengers) 1992: The Infinity War 1992-93: X-Cutioner's Song (X-Men/X-Factor/X-Force) 1992: Rise of the Midnight Sons 1993: Infinity Crusade 1993: Maximum
Francis Dolarhyde (1,912 words) [view diff] exact match in snippet view article find links to article
being under the control of an outside influence, which he referred to as "Factor X". Harris had consulted with FBI Agent John E. Douglas prior to writing
Cable (character) (7,641 words) [view diff] exact match in snippet view article
X-Men #40–41, X-Men Alpha, Amazing X-Men #1–4, Astonishing X-Men #1–4, Factor X #1–4, Gambit & the X-Ternals #1–4, Generation Next #1–4, Weapon X #1–4
Morlocks (comics) (5,431 words) [view diff] exact match in snippet view article
Uncanny X-Men #395. Marvel Comics. Uncanny X-Men #396. Marvel Comics. Factor X #1. Marvel Comics. X-Men: The Age of Apocalypse #2. Marvel Comics. Buxton
Olly Murs (7,320 words) [view diff] case mismatch in snippet view article find links to article
2012. Retrieved 1 September 2012. Olly Murs – All finalists ITV – The X Factor 'X Factor' Week Four: What The Judges Said Digital Spy, 31 October 2009 'X
Tea and Toast (436 words) [view diff] case mismatch in snippet view article find links to article
And Toast - The X Factor UK 2012. YouTube http://www.unrealitytv.co.uk/x-factor/x-factor-2012-lucy-spraggan-explains-the-inspiration-behind-tea-and-toas
NFX1 (684 words) [view diff] no match in snippet view article find links to article
PMC 1782705. PMID 12047746. "Entrez Gene: NFX1 nuclear transcription factor, X-box binding 1". Maruyama K, Sugano S (1994). "Oligo-capping: a simple
Fossil fuel power station (5,789 words) [view diff] case mismatch in snippet view article find links to article
estimated with the following formula: CO2 emissions = capacity x capacity factor x heat rate x emission intensity x time where "capacity" is the "nameplate
Snake venom (7,054 words) [view diff] no match in snippet view article find links to article
Hyaluronidase All species NAD-Nucleotidase All species Kininogenase Viperidae Factor-X activator Viperidae, Crotalinae Heparinase Crotalinae α-Fibrinogenase Viperidae
Arthur Melton (1,700 words) [view diff] exact match in snippet view article find links to article
number of trials of list two). They found a phenomenon, which they called Factor X, that was large and systematically increased with the amount of interpolated
Forge (character) (5,101 words) [view diff] exact match in snippet view article
information Species Human Mutant Team affiliations United States Army X-Men X-Factor X-Corporation X-Force Notable aliases Maker, Genesis Abilities Superhuman
Marvel Ultimate Collection, Complete Epic and Epic Collection lines (225 words) [view diff] exact match in snippet view article find links to article
#1–2; Factor X #1–2; X-Man #1 August 2006 978-0785118749 3 X-Calibre #2–3; Astonishing X-Men #2–4; Generation Next #2–3; X-Man #2–3; Factor X #3; Amazing
Bibliography of Apocalypse (611 words) [view diff] case mismatch in snippet view article find links to article
(First appearance; commanded the Alliance of Evil, first clashed with X-Factor) X-Factor (vol. 1) #10 (Recruited a Morlock, Plague, to become Pestilence)
Jean Grey (14,777 words) [view diff] exact match in snippet view article find links to article
Full name Jean Elaine Grey Species Human mutant Team affiliations X-Men X-Factor X-Force X-Terminators Muir Island X-Men Seven Brides Of Set Hellfire Club
Root-finding algorithms (3,972 words) [view diff] case mismatch in snippet view article find links to article
root r has been found, one may use Euclidean division for removing the factor x – r from the polynomial. Computing a root of the resulting quotient, and
Stefan Koković (239 words) [view diff] case mismatch in snippet view article find links to article
the age of 22 he was a contestant in a talent show franchise of The X FactorX Faktor Adria. Even with a noticeable music success, he stopped singing
Constructible number (4,689 words) [view diff] case mismatch in snippet view article find links to article
roots of the polynomial x 7 − 1 {\displaystyle x^{7}-1} . Removing the factor x − 1 {\displaystyle x-1} , dividing by x 3 {\displaystyle x^{3}} , and substituting
D-Metal Stars (556 words) [view diff] exact match in snippet view article find links to article
ex-Quiet Riot, etc...) - Bass John Bruno (Obsession, Michael Vescera, and X Factor X) - Guitar / Backing Vocals BJ Zampa (House of Lords, ex-Yngwie Malmsteen
Roger Cruz (805 words) [view diff] no match in snippet view article find links to article
Hulk, Uncanny X-Men, X-Men Alpha, X-Patrol, Generation X, X-Calibre, X-Factor, X-Man, Avengers: Timeslide and Silver Surfer. He also worked for DC Comics
Gambit (comics) (11,632 words) [view diff] exact match in snippet view article
Alter ego Remy Etienne LeBeau Species Human Mutant Team affiliations X-Factor X-Men Marauders Horsemen of Apocalypse XSE LeBeau Clan Thieves' Guild Crimson
Cláudia Vieira (623 words) [view diff] exact match in snippet view article find links to article
Portugal. 13 August 2013. Retrieved 15 November 2013.[permanent dead link] "Factor X chega a Portugal" [X Factor arrives in Portugal]. Musical Covers. Archived
Dance Dance Revolution Solo (1,056 words) [view diff] no match in snippet view article find links to article
"CAN'T STOP FALLIN' IN LOVE" NAOKI "CELEBRATE NITE" N.M.R "WILD RUSH" FACTOR-X "SEXY PLANET" Crystal Aliens "LOVE THIS FEELIN'" Chang Ma "TRIP MACHINE
C1D (706 words) [view diff] exact match in snippet view article find links to article
interaction of the nuclear matrix protein C1D with Translin-associated factor X (TRAX)". J. Cell Sci. 115 (Pt 1): 207–16. PMID 11801738. Zamir I, Dawson
Mortal Kombat (2011 video game) (7,116 words) [view diff] no match in snippet view article
Kombat Komplete Edition confirmed". Eurogamer. Retrieved March 25, 2011. FacTor-X. "Ed Boon Teases PC Gamers by Suggesting Mac Version of Mortal Kombat"
The X Factor (British series 5) (3,220 words) [view diff] case mismatch in snippet view article
Shopper. 6 August 2008. Retrieved 10 August 2008.[permanent dead link] "X Factor | X Factor Judges' House Part 2 Wk41 – ITV Press Centre". Itv.com. Archived
Equivalence (formal languages) (681 words) [view diff] no match in snippet view article
<term> <term> ::= <factor> | <term> "*" <factor> | <term> "/" <factor> <factor> ::= "x" | "y" | "z" | "1" | "2" | "3" | "(" <expression> ")" Both grammars
Minimal polynomial (linear algebra) (1,491 words) [view diff] exact match in snippet view article
completely over F into distinct linear factors. The fact that there is only one factor X − λ for every eigenvalue λ means that the generalized eigenspace for λ
X-Men: Legacy (2,017 words) [view diff] exact match in snippet view article find links to article
#320–321, Cable #20, X-Men Alpha, Amazing X-Men #1–4, Astonishing X-Men #1–4, Factor X #1–4, Gambit & the X-Ternals #1–4, Generation Next #1–4, Weapon X #1–4
Quintic function (4,024 words) [view diff] no match in snippet view article find links to article
+ b {\displaystyle x^{5}+ax^{2}+b} , which are (where s is a scaling factor): x 5 − 2 s 3 x 2 − s 5 5 {\displaystyle x^{5}-2s^{3}x^{2}-{\frac {s^{5}}{5}}}
A. E. van Vogt (6,077 words) [view diff] exact match in snippet view article find links to article
(1977) 1974 The Man with a Thousand Names 1974 The Secret Galactics Earth Factor X (1976) 1977 Supermind Fix-up of three short stories, originally published
Torricelli's equation (964 words) [view diff] case mismatch in snippet view article find links to article
{a}\left(x_{f}-x_{i}\right)={\frac {v_{f}^{2}}{2}}-{\frac {v_{f}^{2}}{2}}} The factor x f − x i {\textstyle x_{f}-x_{i}} is the displacement Δ x {\textstyle \Delta
List of Marvel Comics publications (F–G) (4,798 words) [view diff] no match in snippet view article
Marvel Comics publications (T–V) List of Marvel Comics publications (W–Z) "Factor-X (1995) comic books". www.mycomicshop.com. Retrieved 2019-09-01. "Falcon
Katharine Bishop (664 words) [view diff] exact match in snippet view article find links to article
sperm-forming cells in the testes would deteriorate. Initially called "Factor X", Bishop and Evans narrowed down that this factor came from the lipid extract
Rhabdophis subminiatus (921 words) [view diff] exact match in snippet view article find links to article
snake, Rhabdophis subminiatus, showed that the venom contained a potent Factor X activator and had intense defibrinogenating activity; the overall proteolytic
Sickness behavior (2,358 words) [view diff] exact match in snippet view article find links to article
However, in the 1960s, it was shown that animals produced a blood-carried factor X that acted upon the brain to cause sickness behavior. In 1987, Benjamin
Jamie Madrox (5,991 words) [view diff] exact match in snippet view article find links to article
New Mexico Team affiliations X-Factor Investigations Muir Island X-Men X-Factor X-Corps X-Corporation Fallen Angels Nasty Boys S.H.I.E.L.D. HYDRA Notable
Shaken baby syndrome (5,134 words) [view diff] case mismatch in snippet view article find links to article
2004.01977.x. PMID 15660885. S2CID 35179068. Dettman G (March 1978). "Factor "X", sub-clinical scurvy and S.I.D.S. Historical. Part 1". The Australasian
Andriy Bednyakov (336 words) [view diff] exact match in snippet view article find links to article
Блокбастери 2015, 2016 I believe — I do not believe Верю — не верю 2016 X Factor X-Фактор / X-Фактор (Украина) 2016 Provodnik Проводник 2018 Bednyakov +1
Rictor (4,477 words) [view diff] exact match in snippet view article find links to article
Species Human Mutant Team affiliations X-Factor Investigations Purifiers X-Factor X-Terminators New Mutants Weapon P.R.I.M.E. X-Force X-Corporation Abilities
Erwin Bünning (1,869 words) [view diff] exact match in snippet view article find links to article
"Factor X" hypothesis, which held that circadian rhythms were not endogenous, and were instead reliant on an unknown external stimulus, some "Factor X
Ante Pavelić (11,921 words) [view diff] exact match in snippet view article find links to article
young poet Lily Vidić, who compete in the NDH's fictional talent show "Factor X" whose winner wins the chance to perform at the Pavelić's reception for
Music of Dance Dance Revolution Extreme (3,840 words) [view diff] no match in snippet view article find links to article
TSUGARU (APPLE MIX) RevenG VS DE-SIRE WILD RUSH (FROM NONSTOP MEGAMIX) FACTOR-X 祭 JAPAN (FROM NONSTOP MEGAMIX) RE-VENGE Does not appear COW GIRL BAMBEE
Dance Dance Revolution (1998 video game) (3,827 words) [view diff] no match in snippet view article
feat. Tail Bros. from Dance Dance Revolution Solo Bass Mix "WILD RUSH" FACTOR-X from Dance Dance Revolution Solo 2000 Dancing Stage True Kiss Destination
Our Posthuman Future (1,515 words) [view diff] exact match in snippet view article find links to article
animals. Fukuyama refers to the irreducible totality of these qualities as "Factor X", "the complex whole" as opposed to "the sum of simple parts", which forms
Run for Your Life (Matt Cardle song) (830 words) [view diff] case mismatch in snippet view article
2013. "Matt Cardle 'nervous' performing in front of Gary Barlow on 'X Factor' – X Factor News – Music". Digital Spy. 27 September 2011. Retrieved 8 October
List of Ultimate X-Men story arcs (6,330 words) [view diff] exact match in snippet view article find links to article
Hellions Marauders New Mutants S.W.O.R.D. Way of X Wolverine X-Corp X-Factor X-Force X-Men X-Men Legends Upcoming titles X-Men Past team titles A+X All-New
X Factor (Danish season 14) (968 words) [view diff] no match in snippet view article
dk/2021-03-19-det-skal-de-synge-i-fjerde-liveshow https://www.seoghoer.dk/reality/x-factor/x-factor-liveshow-det-skal-de-synge-i-aften https://www.billedbladet
Cyclops (Marvel Comics) (20,441 words) [view diff] exact match in snippet view article
Tales From The Age of Apocalypse vol.1 #2 (1997) X-Man #-1 Weapon X #1 Factor X 03 (1995) X-Men: Omega #1 X-Men: Age of Apocalypse One-Shot Amazing Spider-Man:
King of the Ring (2001) (2,659 words) [view diff] case mismatch in snippet view article
episode of Raw is War, Hardy Boyz (Matt Hardy and Jeff Hardy) defeated X-Factor (X-Pac and Justin Credible) in a tag team match when Jeff pinned X-Pac. After
Pharming (genetics) (5,509 words) [view diff] exact match in snippet view article
thrombosis in chimpanzees by an anti-human tissue factor antibody targeting the factor X binding site". Thrombosis and Haemostasis. 103 (1): 224–33. doi:10.1160/TH09-06-0400
List of Dance Dance Revolution songs (513 words) [view diff] no match in snippet view article find links to article
X3 vs 2ndMix WILD RUSH FACTOR-X Solo 2000, 4thMix, Konamix, Extreme (NA), DDR (PC) WILD RUSH (FROM NONSTOP MEGAMIX) FACTOR-X Extreme (NA), Ultramix 3
GOLGA3 (894 words) [view diff] no match in snippet view article find links to article
cDNAs encoding four novel proteins that interact with translin associated factor-X". Genomics. 79 (6): 799–808. doi:10.1006/geno.2002.6779. PMID 12036294
Gibbs sampling (6,122 words) [view diff] case mismatch in snippet view article find links to article
practice, to determine the nature of the conditional distribution of a factor x j {\displaystyle x_{j}} , it is easiest to factor the joint distribution
Macintosh clone (2,599 words) [view diff] no match in snippet view article find links to article
PowerCurve, PowerTower/Pro, PowerWave PowerEx StepMAC PowerTools Infinity, X-Factor, X-Force Radius System 100, System 81/110 RedBox Expression 604e Shaye Shaye
Tests of special relativity (3,371 words) [view diff] no match in snippet view article find links to article
2 {\displaystyle \gamma =1/{\sqrt {1-v^{2}/c^{2}}}} being the Lorentz factor: x ′ = γ ( x − v t ) ,   y ′ = y ,   z ′ = z ,   t ′ = γ ( t − v x c 2 )
Celebrity Big Brother (British series 9) (1,995 words) [view diff] case mismatch in snippet view article
Magazine. Retrieved 6 January 2012. "Frankie Cocozza axed from 'The X Factor' - X Factor News - TV". Digital Spy. Retrieved 11 November 2011. Gareth Thomas
AKAP9 (1,614 words) [view diff] no match in snippet view article find links to article
cDNAs encoding four novel proteins that interact with translin associated factor-X". Genomics. 79 (6): 799–808. doi:10.1006/geno.2002.6779. PMID 12036294
Margaret Oakley Dayhoff (2,360 words) [view diff] exact match in snippet view article find links to article
ovalbumin; epidermal growth factor and the light chain of coagulation factor X; and apolipoproteins A-I, A-II, C-I and C-III. Based on this work, Dayhoff
VKORC1 (1,471 words) [view diff] exact match in snippet view article find links to article
in some blood-clotting proteins, including factor VII, factor IX, and factor X. VKORC1 is of therapeutic interest both for its role in contributing to
Jørgen Kastholm (1,988 words) [view diff] no match in snippet view article find links to article
Fair Game. Lufthavns Bænken Terminal 7100. Kusch + co. 2012 Danish X-factor. X-Chair. Lange Production. 2014 The Most Wanted Man. The Tulip Chair. FK
ORM1 (960 words) [view diff] exact match in snippet view article find links to article
through somatic cell hybrids and cDNA probes of protein C to chromosome 2, factor X to chromosome 13, and alpha 1-acid glycoprotein to chromosome 9". Hum.
Pheochromocytoma (15,707 words) [view diff] exact match in snippet view article find links to article
Nervous System) SDHx (Succinate Dehydrogenase Subunit x) MAX (MYC Associated Factor X); TMEM127 (Transmembrane Protein 127) There have been several published
Sum and Product Puzzle (1,644 words) [view diff] exact match in snippet view article find links to article
space got "sparser" when the prime number 2 is no longer available as the factor X, creating fewer possible products X·Y from a given sum A. When there are
Promise This (2,391 words) [view diff] no match in snippet view article find links to article
October 2010. Retrieved 25 October 2010. http://www.unrealitytv.co.uk/x-factor/x-factor-adele-covers-cheryl-coles-promise-this-on-radio-1-live-lounge/ "The
Stay (Rihanna song) (7,079 words) [view diff] case mismatch in snippet view article
Retrieved February 15, 2013. "X FACTOR INDONESIA: Fatin Pantas Stay di X Factor" [X FACTOR INDONESIA: Fatin deserve Stay on X Factor] (in Indonesian). bisnis-jabar
Utility ratemaking (1,852 words) [view diff] case mismatch in snippet view article find links to article
the price in time t. RPI is the rate of inflation. X is the efficiency factor (X-factor). P(t-1) is the price in time (t - 1). Since the price is set with
RANDU (734 words) [view diff] no match in snippet view article find links to article
}=(2^{16}+3)^{2}x_{k}\,} which becomes, after expanding the quadratic factor: x k + 2 = ( 2 32 + 6 ⋅ 2 16 + 9 ) x k = [ 6 ⋅ ( 2 16 + 3 ) − 9 ] x k {\displaystyle
Quartic equation (4,997 words) [view diff] case mismatch in snippet view article find links to article
is a root. In either case the full quartic can then be divided by the factor (x − 1) or (x + 1) respectively yielding a new cubic polynomial, which can
Marvel Omnibus (229 words) [view diff] exact match in snippet view article find links to article
Comics Presents #36; Marvel Fanfare #59 1,160 January 5, 2011 0785143262 X-Factor X-Factor by Peter David 1 X-Factor (1986) #55, 70-92, Annual (1986) #7-8;
Hymenoxys odorata (395 words) [view diff] exact match in snippet view article find links to article
Steel, E. G.; Witzel, D. A.; Blanks, A. (1976). "Acquired coagulation factor X activity deficiency connected with Hymenoxys odorata DC (Compositae), bitterweed
Human nutrition (19,339 words) [view diff] exact match in snippet view article find links to article
vitamin E as essential for rat pregnancy, originally calling it "food factor X" until 1925. In 1925 Hart discovered that iron absorption requires trace
Maria Manuel Mota (1,643 words) [view diff] exact match in snippet view article find links to article
Sousa (1 Oct 2009). "Up Magazine – TAP Portugal » Maria Manuel Mota — The factor X". upmagazine-tap.com. Retrieved 2019-01-05. "iMM Lisboa — Mota, Maria M
Lonomia obliqua (1,390 words) [view diff] exact match in snippet view article find links to article
Caterpillar Spicules Trigger Human Blood Coagulation via Activation of Factor X and Prothrombin". Thrombosis and Haemostasis. 79 (3): 539–542. doi:10.1055/s-0037-1614940
Laser Inertial Fusion Energy (6,522 words) [view diff] case mismatch in snippet view article find links to article
efficiency. Over a year, LIFE would produce 365 days x 24 hours x 0.9 capacity factor x 1,000,000 kW nameplate rating = 8 billion kWh. In order to generate that
Corporate average fuel economy (11,957 words) [view diff] no match in snippet view article find links to article
would have a CAFE calculated as follows: Fuel Economy = (1/(0.15 AMFA factor)) x (15mpg) = 100 miles per gallon, providing a very healthy economic incentive
The X Factor (British series 9) (12,220 words) [view diff] case mismatch in snippet view article
2012. Daniels, Colin (19 May 2012). "Rod Stewart 'to guest judge The X Factor' – X Factor News – Reality TV – Digital Spy". Digital Spy. Retrieved 25 May
Linearised polynomial (1,107 words) [view diff] case mismatch in snippet view article find links to article
sense since any linearised polynomial of degree > 1 has the nontrivial factor x. A linearised polynomial L(x) over Fq is symbolically irreducible if and
Cherry Poppin' Daddies (10,451 words) [view diff] exact match in snippet view article find links to article
2002. Retrieved April 3, 2010. "Cherry Poppin' Daddies at Club Lingerie". Factor X magazine. March 1994. Mitchell, Grace (February 19, 1996). "New CD Covers
ARHGEF6 (1,618 words) [view diff] exact match in snippet view article find links to article
domain. Rho family of GTPases Scaffold protein Guanine nucleotide exchange factor X-linked intellectual disability GRCh38: Ensembl release 89: ENSG00000129675
Ruffini's rule (3,282 words) [view diff] case mismatch in snippet view article find links to article
factor that polynomial using those roots. As is well-known, each linear factor (x − r), which divides a given polynomial corresponds with a root r and vice
Insatiable (Nadine Coyle song) (1,546 words) [view diff] case mismatch in snippet view article
2010. Retrieved 8 September 2010. "Nadine Coyle: 'I wouldn't go on X Factor' – X Factor News – TV". Digital Spy. 25 October 2010. Retrieved 25 October
Publication history of Marvel Comics crossover events (739 words) [view diff] exact match in snippet view article find links to article
X-Ternals, Generation Next, Astonishing X-Men, Amazing X-Men, Weapon X, Factor X, X-Man and X-Universe. The event was bookended by two one shots, X-Men
The Halo Effect (book) (1,374 words) [view diff] exact match in snippet view article
correlation is causation. The Delusion of Single Explanations: arguments that factor X improves performance by 40% and factor Y improves by another 40%, so both
Index of physics articles (S) (3,244 words) [view diff] case mismatch in snippet view article
Shamit Kachru Shanghai Synchrotron Radiation Facility Shannon Walker Shape factor (X-ray diffraction) Shape factor (boundary layer flow) Shape of the universe
Frobenius normal form (2,831 words) [view diff] exact match in snippet view article find links to article
, which is a multiple of the minimal polynomial by a factor X 2 − X − 1 {\displaystyle X^{2}-X-1} . There always exist vectors such that
List of X-Men limited series and one-shots (3,585 words) [view diff] exact match in snippet view article find links to article
1–4 Fabian Nicieza (W) Andy Kubert, Matt Ryan (A) replaces X-Men vol. 1 Factor X vol. 1 1–4 John Francis Moore (W) Steve Epting, Terry Dodson, Al Milgrom
Lehmer random number generator (3,414 words) [view diff] case mismatch in snippet view article find links to article
(m-r)/a\\&=(a/a)\cdot (m-r)\\&=(m-r)\\&\equiv -r{\pmod {m}}\\\end{aligned}}} so if we factor x = (x mod q) + q⌊x/q⌋, we get: a x = a ( x mod q ) + a q ⌊ x / q ⌋ = a (
No Mercy (2001) (4,022 words) [view diff] case mismatch in snippet view article
insulting the fans and insulted both of them. This led to Christian and X-Factor (X-Pac and Albert) attacking Edge, until Acolytes Protection Agency (Faarooq
Casus irreducibilis (2,829 words) [view diff] case mismatch in snippet view article find links to article
rational root x1, then the quintic is reducible since it can be written as a factor (x—x1) times a quartic polynomial. But if the test shows that there is no
UNC84A (726 words) [view diff] no match in snippet view article find links to article
cDNAs encoding four novel proteins that interact with translin associated factor-X". Genomics. 79 (6): 799–808. doi:10.1006/geno.2002.6779. PMID 12036294
Enrique Ramil discography (45 words) [view diff] exact match in snippet view article find links to article
Juguetes Rotos Tercera Planta «Si me caigo...» 2018 «The Sound of Silence» Factor X Directos Sony Music «Hombres» «Toy» «Muera el amor» 2019 «Volcanes» Volcanes
The Natural Step (4,162 words) [view diff] exact match in snippet view article find links to article
sustainability tools and concepts have been described). Below various examples: Factor X; Factor 4; Factor 10; biological footprinting; IS0 14001; EMAS; EMS [1]
Disney Super Guitar (239 words) [view diff] exact match in snippet view article find links to article
brother) Rhythm guitar = John Bruno (Obsession, Michael Vescera, and X Factor X) Drums = BJ Zampa (House of Lords, ex-Yngwie Malmsteen, ex-Obsession, and
Basis expansion time-frequency analysis (665 words) [view diff] no match in snippet view article find links to article
the central frequency. σ {\displaystyle \sigma } controls the scaling factor. x ( t ) ≈ ∑ a t 0 , f 0 , σ , η ⋅ φ t 0 , f 0 , σ , η ( t ) {\displaystyle
Coppersmith's attack (2,890 words) [view diff] case mismatch in snippet view article find links to article
{\displaystyle g_{2}(x)=x^{e}-C_{2}\in \mathbb {Z} _{N}[x]} . The linear factor x − M 2 {\displaystyle x-M_{2}} divides both polynomials. Therefore, Eve
Calcium-binding EGF domain (443 words) [view diff] exact match in snippet view article find links to article
of the calcium form of the NH2-terminal EGF-like domain in coagulation factor X". J. Biol. Chem. 267 (27): 19642–9. PMID 1527084. Rao Z, Handford P, Mayhew
Dance Dance Revolution Extreme Limited Edition Music Sampler (298 words) [view diff] no match in snippet view article find links to article
MIX) Akira Yamaoka feat. Mary Elizabeth McGlynn ELECTRO R&B 5 WILD RUSH FACTOR-X AMBIENT BREAKS 6 A Stupid Barber Sho-T EURO HOUSE 7 MOBO★MOGA Orange Lounge
Histophilus somni (3,443 words) [view diff] exact match in snippet view article find links to article
species is that Histophilus species are able to grow in the absence of Factor X (heat stable hemin) and Factor V (NAD) although their growth is increased
La Voz (American season 1) (1,324 words) [view diff] exact match in snippet view article
and finished in the top 8. Brisila Barros was on the first season of El Factor X United States. Jeidimar Rijos competed on the first season of La Voz Kids
List of Marvel Comics first appearances (1,988 words) [view diff] exact match in snippet view article find links to article
Lashley Excalibur #86 Bedlam 1995-03 John Francis Moore, Steve Epting Factor X #1 Flipside 1995-03 Peter David, Joe St. Pierre Spider-Man 2099 #29 X-Man
TEX9 (1,177 words) [view diff] exact match in snippet view article find links to article
GAATTGTAATTCAAGGTCATAAA and AGTGATTTGCCCAAGG/CCATATA + and + Regulatory factor X, 4 TTAGGTCTTTGATACATT and AGCCATTGGCGCAGCGTCA + and - Thyroid hormone receptor
List of programs broadcast by MBC 4 (3,181 words) [view diff] exact match in snippet view article find links to article
Outsourced Dallas Melrose Place Hellcats Kitchen Millionaire Mercy The X Factor X Factor UK The Defenders Philanthropist The Philanthropist Mr. Selfridge
Kristín Vala Ragnarsdóttir (1,871 words) [view diff] exact match in snippet view article find links to article
megatrends and resource use - A systemic reflection. In H. Lehmann (ed) Factor X. Eco-Efficiency in Industry and Science vol 32. Springer, Berlin. Thorarinsdottir
C9orf85 (1,339 words) [view diff] exact match in snippet view article find links to article
0.878 AP2F Transcription factor AP-2, alpha 0.931 EBOX MYC associated factor X 0.926 GCMF Glial cells missing homolog 1, chorion-specific transcription
Management system (open source) (3,390 words) [view diff] exact match in snippet view article
correlation is causation. The Delusion of Single Explanations: arguments that factor X improves performance by 40% and factor Y improves by another 40%, so both
List of films banned in Chile (351 words) [view diff] exact match in snippet view article find links to article
Bad girls # 3 cellblock 69 20 December 1995 Mind Games 21 December 1995 Factor X 21 December 1995 Videos de mejoramiento sexual vol 3 27 December 1995 Solo
TMEM247 (1,688 words) [view diff] exact match in snippet view article find links to article
muscle-specific Mt binding site 1128 (+) 0.906 tggaATCTg V$RFX3.02 Regulatory factor X, 3 (secondary DNA binding preference) 1278 (+) 0.889 gatggtgcctgGTGActcc
SLC46A3 (6,439 words) [view diff] exact match in snippet view article find links to article
Genomatix with a matrix similarity of 0.994, dimerizes with myc-associated factor X (MAX) to affect gene expression in a way that increases cell proliferation